Overview

Cluster Contents
Total G4 sequences53,210
By G4hunter53,210
By regular expression0
Average Sequence Length26
Number of associated genomes4 View Genomes
Taxonomic Distribution
Bacteria0 %
Archaea0 %
Eukaryota100 %
Viruses0 %



Sequence Contents

Multiple Sequence Alignment
Note: For efficiency, the top 1000 sequences of the alignment are shown. To view the full alignment, please use the Multiple Sequence Alignment button at the top of the page.

Representative Sequence
Organism GroupGenomeNameContigStartEndDetection Method
Eukaryota (Mammals) GCA_020976825.1 Odocoileus hemionus CM037421.1 30,520,510 30,520,536 G4hunter
Sequence
ACAGCCCACCAGGCTCCCCCGTCCCT



x
This website uses cookies to improve user experience. By using this service you consent to all cookies in accordance with our privacy policy. OK