Overview

Cluster Contents
Total G4 sequences43,519
By G4hunter43,519
By regular expression0
Average Sequence Length31
Number of associated genomes1 View Genomes
Taxonomic Distribution
Bacteria0 %
Archaea0 %
Eukaryota100 %
Viruses0 %



Sequence Contents

Multiple Sequence Alignment
Note: For efficiency, the top 1000 sequences of the alignment are shown. To view the full alignment, please use the Multiple Sequence Alignment button at the top of the page.

Representative Sequence
Organism GroupGenomeNameContigStartEndDetection Method
Eukaryota (Other Vertebrates) GCA_029206835.1 Rana muscosa CM055116.1 1,013,085,271 1,013,085,302 G4hunter
Sequence
ACACACCTCTCTCCTCCACCCCCTCCTCTTC



x
This website uses cookies to improve user experience. By using this service you consent to all cookies in accordance with our privacy policy. OK