Cluster Contents | |
---|---|
Total G4 sequences | 43,548 |
By G4hunter | 43,548 |
By regular expression | 0 |
Average Sequence Length | 31 |
Number of associated genomes | 1 View Genomes |
Taxonomic Distribution | |
---|---|
Bacteria | 0 % |
Archaea | 0 % |
Eukaryota | 100 % |
Viruses | 0 % |
Multiple Sequence Alignment |
---|
Note: For efficiency, the top 1000 sequences of the alignment are shown. To view the full alignment, please use the Multiple Sequence Alignment button at the top of the page. |
Sequence Logo |
---|
Representative Sequence | ||||||
---|---|---|---|---|---|---|
Organism Group | Genome | Name | Contig | Start | End | Detection Method |
Eukaryota (Other Vertebrates) | GCA_029206835.1 | Rana muscosa | CM055116.1 | 101,854,133 | 101,854,164 | G4hunter |
Sequence | ||||||
GAAGAGGAGGGGGTGGAGGAGAGAGGTGTGT |