| Cluster Contents | |
|---|---|
| Total G4 sequences | 41,441 |
| By G4hunter | 41,441 |
| By regular expression | 0 |
| Average Sequence Length | 35 |
| Number of associated genomes | 1 View Genomes |
| Taxonomic Distribution | |
|---|---|
| Bacteria | 0 % |
| Archaea | 0 % |
| Eukaryota | 100 % |
| Viruses | 0 % |
| Multiple Sequence Alignment |
|---|
| Note: For efficiency, the top 1000 sequences of the alignment are shown. To view the full alignment, please use the Multiple Sequence Alignment button at the top of the page. |
| Sequence Logo |
|---|
| Representative Sequence | ||||||
|---|---|---|---|---|---|---|
| Organism Group | Genome | Name | Contig | Start | End | Detection Method |
| Eukaryota (Other Vertebrates) | GCA_029206835.1 | Rana muscosa | CM055116.1 | 313,473,436 | 313,473,471 | G4hunter |
| Sequence | ||||||
| ACGGATGGGAGGGGCTTATATAGGGGAGGGTACTT | ||||||