| Cluster Contents | |
|---|---|
| Total G4 sequences | 200,916 |
| By G4hunter | 0 |
| By regular expression | 200,916 |
| Average Sequence Length | 21 |
| Number of associated genomes | 399 View Genomes |
| Taxonomic Distribution | |
|---|---|
| Bacteria | 0 % |
| Archaea | 0 % |
| Eukaryota | 99 % |
| Viruses | 1 % |
| Multiple Sequence Alignment |
|---|
| Note: For efficiency, the top 1000 sequences of the alignment are shown. To view the full alignment, please use the Multiple Sequence Alignment button at the top of the page. |
| Sequence Logo |
|---|
| Representative Sequence | ||||||
|---|---|---|---|---|---|---|
| Organism Group | Genome | Name | Contig | Start | End | Detection Method |
| Eukaryota (Fungi) | GCA_000143535.4 | Botrytis cinerea B05.10 | CP009820.1 | 75 | 96 | Regular Expression |
| Sequence | ||||||
| CCCTAACCCTAACCCTAACCC | ||||||